yjeA [2017-10-15 16:36:05]

peptidoglycan deacetylase C

locus: BSU12100

pI: 9.10

mw: 53.67 kDa

protein length: 467 aa

gene length: 1401 bp

function: cell wall modification

product: polysaccharide deacetylase C

essential: no

synonyms: pdaC

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 1,281,128 → 1,282,531

Phenotypes of a mutant

• sensitive to lysozyme treatment [Pubmed|22277649]

The protein

Catalyzed reaction/ biological activity

• deacetylates N-acetylmuramic acid (MurNAc) but not GlcNAc from peptidoglycan [Pubmed|22277649]

Protein family

• polysaccharide deacetylase family (according to Swiss-Prot)

Paralogous protein(s)

• [protein|2E2D21BEA164C7EB93B6A3F3C990ABD475920A81|YheN]

[SW|Domains]

• aa 55 - 140: DUF4163
• aa 155 - 235: DUF3298
• aa 278 - 452: NodB domain

Structure

• [PDB|2C1G] (the NodB domain, from Streptococcus pneumoniae, 47% identity) [pubmed|16221761]
• [PDB|3S5T] (the DUF3298 domain, from Bacteroides fragilis, 27% identity)

Expression and Regulation

Operons

• genes: [gene|603E226CE488A25C4E28A6A7363CCD65BE64BB21|pdaC]
  description: [pubmed|22383849]

  regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: repression, in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]

Biological materials

Mutant

• MGNA-A355 (yjeA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/355 NBRP B. subtilis, Japan]
• BKE12100 (Δ[gene|603E226CE488A25C4E28A6A7363CCD65BE64BB21|pdaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAAAACTCCTTCTTTC, downstream forward: _UP4_TAAATTAGAAAAGGCTGTCC
• BKK12100 (Δ[gene|603E226CE488A25C4E28A6A7363CCD65BE64BB21|pdaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAAAACTCCTTCTTTC, downstream forward: _UP4_TAAATTAGAAAAGGCTGTCC

References

• 17878218,17581128,22277649,23199363,26883633,16221761